Sequence retrieval

Genome: Listeria monocytogenes EGD
Start position: 2369898
End position: 2369921
Length: 24

DNA sequence
>NC_022568, from 2369898 to 2369921 (24 bp); Listeria monocytogenes EGD TTGCTTTTCCTTCTGCTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2369048-2369959	Sequence	LMON_2352 - Pseudouridine 5'-phosphate glycosidase (Protein is coded in complementary strand; from 2369959 to 2369048)