Sequence retrieval

Genome: Listeria monocytogenes EGD
Start position: 2601539
End position: 2601562
Length: 24

DNA sequence
>NC_022568, from 2601539 to 2601562 (24 bp); Listeria monocytogenes EGD CTAATTCTGATTCTAATTGTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2601406-2601855	Sequence	LMON_2577 - hypothetical fig\|282458.1.peg.583 homolog (Protein is coded in complementary strand; from 2601855 to 2601406)