Sequence retrieval

Genome: Listeria monocytogenes EGD
Start position: 2735384
End position: 2735407
Length: 24

DNA sequence
>NC_022568, from 2735384 to 2735407 (24 bp); Listeria monocytogenes EGD CACTAACACTAACACGAACGCTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2733973-2735745	Sequence	LMON_2714 - Membrane-bound lytic murein transglycosylase D precursor