Sequence retrieval

Genome: Listeria monocytogenes EGD
Start position: 1869999
End position: 1870034
Length: 36

DNA sequence
>NC_022568, from 1869999 to 1870034 (36 bp); Listeria monocytogenes EGD CATCCGCATCAGCGTCAGCATCAGCATCGGCATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1869749-1871401	Sequence	LMON_1866 - Putative peptidoglycan bound protein (LPXTG motif) Lmo1799 homolog (Protein is coded in complementary strand; from 1871401 to 1869749)