Sequence retrieval

Genome: Listeria monocytogenes EGD
Start position: 692637
End position: 692676
Length: 40

DNA sequence
>NC_022568, from 692637 to 692676 (40 bp); Listeria monocytogenes EGD TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 692174-693094	Sequence	LMON_0679 - Motility gene repressor MogR # frameshift (Protein is coded in complementary strand; from 693094 to 692174)