Sequence retrieval

Genome: Streptococcus suis T15
Start position: 1375817
End position: 1375840
Length: 24

DNA sequence
>NC_022665, from 1375817 to 1375840 (24 bp); Streptococcus suis T15 TGCTTCTGCTTTCGCTTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1375302-1376249	Sequence	T15_1357 arcC carbamate kinase (Protein is coded in complementary strand; from 1376249 to 1375302)