Sequence retrieval

Genome: Streptococcus suis T15
Start position: 1918984
End position: 1919007
Length: 24

DNA sequence
>NC_022665, from 1918984 to 1919007 (24 bp); Streptococcus suis T15 TCTTCCTCTTGCTCTACCTCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1918669-1919391	Sequence	T15_1938 - Negative regulator of genetic competence (Protein is coded in complementary strand; from 1919391 to 1918669)