Sequence retrieval

Genome: Streptococcus suis T15
Start position: 626315
End position: 626347
Length: 33

DNA sequence
>NC_022665, from 626315 to 626347 (33 bp); Streptococcus suis T15 AAAACCTTGGAAAAAGGTTGGAAAATCCTTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 625701-626399	Sequence	T15_0607 - polar amino acid ABC transporter permease (Protein is coded in complementary strand; from 626399 to 625701)