Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1207950
End position: 1207981
Length: 32

DNA sequence
>NC_022904, from 1207950 to 1207981 (32 bp); Pandoraea pnomenusa 3kgm TCACCAGCTCACCAGCTCACCAGCTCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1207975-1208718	Sequence	U875_05625 - hypothetical protein (Protein is coded in complementary strand; from 1208718 to 1207975)