Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1298541
End position: 1298570
Length: 30

DNA sequence
>NC_022904, from 1298541 to 1298570 (30 bp); Pandoraea pnomenusa 3kgm CCACGCTTATCCACGCTTATCCACGCTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1298568-1298969	Sequence	U875_06020 - hypothetical protein (Protein is coded in complementary strand; from 1298969 to 1298568)