Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1404802
End position: 1404846
Length: 45

DNA sequence
>NC_022904, from 1404802 to 1404846 (45 bp); Pandoraea pnomenusa 3kgm TATCCCGCATATGCCGCATATGCCGCATATCCCGAATATCCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1404051-1404812	Sequence	U875_06520 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 1404812 to 1404051)