Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1408228
End position: 1408255
Length: 28

DNA sequence
>NC_022904, from 1408228 to 1408255 (28 bp); Pandoraea pnomenusa 3kgm CGCCATGCGTCATGCGTCATGCGTCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1408252-1409010	Sequence	U875_06550 - hypothetical protein (Protein is coded in complementary strand; from 1409010 to 1408252)