Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1428991
End position: 1429017
Length: 27

DNA sequence
>NC_022904, from 1428991 to 1429017 (27 bp); Pandoraea pnomenusa 3kgm GGGCGTGGTGGGCGTGGTGGGCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1427889-1429082	Sequence	U875_06670 - hypothetical protein
ORF. 1428938-1430593	Sequence	U875_06675 - PAS sensor protein (Protein is coded in complementary strand; from 1430593 to 1428938)