Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1459264
End position: 1459296
Length: 33

DNA sequence
>NC_022904, from 1459264 to 1459296 (33 bp); Pandoraea pnomenusa 3kgm GCGCGCTATCGGCCTGCTATCGGCCTGCTATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1459292-1459810	Sequence	U875_06800 - hypothetical protein (Protein is coded in complementary strand; from 1459810 to 1459292)