Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1696720
End position: 1696746
Length: 27

DNA sequence
>NC_022904, from 1696720 to 1696746 (27 bp); Pandoraea pnomenusa 3kgm ATCGAACGGTTCGAACGGTTCGAACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1696577-1697425	Sequence	U875_07800 - hypothetical protein (Protein is coded in complementary strand; from 1697425 to 1696577)