Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1766528
End position: 1766563
Length: 36

DNA sequence
>NC_022904, from 1766528 to 1766563 (36 bp); Pandoraea pnomenusa 3kgm TGCGGGCGAATCGGCGGGCGAATCGGTGGGCGAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1765719-1766597	Sequence	U875_08090 - 3-oxoadipate enol-lactone hydrolase (Protein is coded in complementary strand; from 1766597 to 1765719)