Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 1964391
End position: 1964422
Length: 32

DNA sequence
>NC_022904, from 1964391 to 1964422 (32 bp); Pandoraea pnomenusa 3kgm TCGCGACATCGCGACATCGCGACATCGCGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1964290-1964448	Sequence	U875_08955 - hypothetical protein (Protein is coded in complementary strand; from 1964448 to 1964290)