Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 2161200
End position: 2161226
Length: 27

DNA sequence
>NC_022904, from 2161200 to 2161226 (27 bp); Pandoraea pnomenusa 3kgm CTCGCCTTCCTCGCTTTCCTTGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2159479-2161821	Sequence	U875_09990 - RNA-binding protein (Protein is coded in complementary strand; from 2161821 to 2159479)