Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 2252371
End position: 2252406
Length: 36

DNA sequence
>NC_022904, from 2252371 to 2252406 (36 bp); Pandoraea pnomenusa 3kgm GGCGGGCATGGCGGGCACGTCGGGCATGGCGCGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2251403-2252425	Sequence	U875_10365 - membrane protein (Protein is coded in complementary strand; from 2252425 to 2251403)