Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 2257946
End position: 2257972
Length: 27

DNA sequence
>NC_022904, from 2257946 to 2257972 (27 bp); Pandoraea pnomenusa 3kgm CGCGATCATCGCGATCATCGCGATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2256619-2258088	Sequence	U875_10385 - 3-ketoacyl-ACP reductase (Protein is coded in complementary strand; from 2258088 to 2256619)