Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 2361643
End position: 2361666
Length: 24

DNA sequence
>NC_022904, from 2361643 to 2361666 (24 bp); Pandoraea pnomenusa 3kgm CGATGGCGGTGGGGATGGCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2359848-2361773	Sequence	U875_10825 - hypothetical protein (Protein is coded in complementary strand; from 2361773 to 2359848)