Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 252092
End position: 252131
Length: 40

DNA sequence
>NC_022904, from 252092 to 252131 (40 bp); Pandoraea pnomenusa 3kgm CTCGGGCTCGGTCCGGCTCGGTCGGGCTCGGTCGGGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 252130-252450	Sequence	U875_01190 - hypothetical protein (Protein is coded in complementary strand; from 252450 to 252130)