Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 2693301
End position: 2693324
Length: 24

DNA sequence
>NC_022904, from 2693301 to 2693324 (24 bp); Pandoraea pnomenusa 3kgm GCCGCCGCCGTCTCCGCCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2692740-2693753	Sequence	U875_12315 - hypothetical protein (Protein is coded in complementary strand; from 2693753 to 2692740)