Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 283915
End position: 283950
Length: 36

DNA sequence
>NC_022904, from 283915 to 283950 (36 bp); Pandoraea pnomenusa 3kgm GCTTTTGCGGGCGCTCTTGCGGGCGCTTTTGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 283816-286302	Sequence	U875_01345 - 3-hydroxyalkanoate synthetase (Protein is coded in complementary strand; from 286302 to 283816)