Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3030800
End position: 3030835
Length: 36

DNA sequence
>NC_022904, from 3030800 to 3030835 (36 bp); Pandoraea pnomenusa 3kgm CTCAGAGCACTCTGAGCACTCGGAGCACTCAGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3030829-3031911	Sequence	U875_13855 - diguanylate cyclase (Protein is coded in complementary strand; from 3031911 to 3030829)