Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3076234
End position: 3076261
Length: 28

DNA sequence
>NC_022904, from 3076234 to 3076261 (28 bp); Pandoraea pnomenusa 3kgm TTGGTTCTTGGTTACTGGTTCTTGGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3075800-3076912	Sequence	U875_14150 - hypothetical protein (Protein is coded in complementary strand; from 3076912 to 3075800)