Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3101807
End position: 3101831
Length: 25

DNA sequence
>NC_022904, from 3101807 to 3101831 (25 bp); Pandoraea pnomenusa 3kgm CGTCGCGCCGCGACGCGTGGCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3100638-3102047	Sequence	U875_14335 - (Fe-S)-binding protein (Protein is coded in complementary strand; from 3102047 to 3100638)