Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3315002
End position: 3315046
Length: 45

DNA sequence
>NC_022904, from 3315002 to 3315046 (45 bp); Pandoraea pnomenusa 3kgm CGGGTGACACGGGTGACACGGGTGACACGGGTGACACGGGTGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3313111-3316101	Sequence	U875_15300 - hypothetical protein (Protein is coded in complementary strand; from 3316101 to 3313111)