Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3319065
End position: 3319091
Length: 27

DNA sequence
>NC_022904, from 3319065 to 3319091 (27 bp); Pandoraea pnomenusa 3kgm GGAGATGAAGGAAATGAAGGAGATGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3317911-3319164	Sequence	U875_15315 - cell division protein FtsX (Protein is coded in complementary strand; from 3319164 to 3317911)