Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3374328
End position: 3374351
Length: 24

DNA sequence
>NC_022904, from 3374328 to 3374351 (24 bp); Pandoraea pnomenusa 3kgm GCGCCGACGCCGGCGCCCGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3374303-3375238	Sequence	U875_15605 - lytic transglycosylase (Protein is coded in complementary strand; from 3375238 to 3374303)