Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3388215
End position: 3388238
Length: 24

DNA sequence
>NC_022904, from 3388215 to 3388238 (24 bp); Pandoraea pnomenusa 3kgm GCATTCGCATTCGCATCCGCATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3388167-3388706	Sequence	U875_15670 - magnesium transporter (Protein is coded in complementary strand; from 3388706 to 3388167)