Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3392210
End position: 3392236
Length: 27

DNA sequence
>NC_022904, from 3392210 to 3392236 (27 bp); Pandoraea pnomenusa 3kgm CGTCACCCGCGTCACCCTTGTCACCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3392155-3393468	Sequence	U875_15690 - CoA transferase (Protein is coded in complementary strand; from 3393468 to 3392155)