Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3483944
End position: 3483970
Length: 27

DNA sequence
>NC_022904, from 3483944 to 3483970 (27 bp); Pandoraea pnomenusa 3kgm ACGGCACTTACTGCACTTACGGCACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3483961-3485469	Sequence	U875_16145 - MlrC family protein 2 (Protein is coded in complementary strand; from 3485469 to 3483961)