Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3554299
End position: 3554334
Length: 36

DNA sequence
>NC_022904, from 3554299 to 3554334 (36 bp); Pandoraea pnomenusa 3kgm CGTCGATTTCGTCGATTTCGTCGATGTCGTCGATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3553076-3554341	Sequence	U875_16470 - CoA transferase (Protein is coded in complementary strand; from 3554341 to 3553076)