Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3608506
End position: 3608532
Length: 27

DNA sequence
>NC_022904, from 3608506 to 3608532 (27 bp); Pandoraea pnomenusa 3kgm CGGCGGAAGCGGCGGAAGCGGCGGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3607560-3608708	Sequence	U875_16705 - D-aminopeptidase (Protein is coded in complementary strand; from 3608708 to 3607560)