Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3702612
End position: 3702638
Length: 27

DNA sequence
>NC_022904, from 3702612 to 3702638 (27 bp); Pandoraea pnomenusa 3kgm CGGGTCCACGGGGTCCACGGGGTCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3701353-3702891	Sequence	U875_17100 - RND transporter (Protein is coded in complementary strand; from 3702891 to 3701353)