Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3708682
End position: 3708708
Length: 27

DNA sequence
>NC_022904, from 3708682 to 3708708 (27 bp); Pandoraea pnomenusa 3kgm TCGTCTGTCTCGTCGGTCTCGTCTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3707367-3708683	Sequence	U875_17125 - citrate synthase (Protein is coded in complementary strand; from 3708683 to 3707367)