Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3757356
End position: 3757382
Length: 27

DNA sequence
>NC_022904, from 3757356 to 3757382 (27 bp); Pandoraea pnomenusa 3kgm CAGTGGGATCGGTGGGATCGGTGGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3756845-3757399	Sequence	U875_17330 - 4-hydroxyphenylacetate 3-monooxygenase (Protein is coded in complementary strand; from 3757399 to 3756845)