Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3801103
End position: 3801132
Length: 30

DNA sequence
>NC_022904, from 3801103 to 3801132 (30 bp); Pandoraea pnomenusa 3kgm TCTTGCGGCTTCTTGGCGCTTCTTACCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3801133-3803418	Sequence	U875_17495 - lysine decarboxylase (Protein is coded in complementary strand; from 3803418 to 3801133)