Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3809744
End position: 3809770
Length: 27

DNA sequence
>NC_022904, from 3809744 to 3809770 (27 bp); Pandoraea pnomenusa 3kgm CGGTAACGTCGGCAACGTCGGTAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3809475-3809750	Sequence	U875_17525 - type 1 capsular polysaccharide biosynthesis protein J