Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3828044
End position: 3828073
Length: 30

DNA sequence
>NC_022904, from 3828044 to 3828073 (30 bp); Pandoraea pnomenusa 3kgm CGTGCTCGTGGTCGTGCTCGTGGTCGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3827185-3828099	Sequence	U875_17610 - cobalamin synthase (Protein is coded in complementary strand; from 3828099 to 3827185)