Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3845891
End position: 3845917
Length: 27

DNA sequence
>NC_022904, from 3845891 to 3845917 (27 bp); Pandoraea pnomenusa 3kgm CGATTTCGACGATTTCGACGATTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3845847-3846785	Sequence	U875_17695 - competence protein ComE (Protein is coded in complementary strand; from 3846785 to 3845847)