Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 3915911
End position: 3915946
Length: 36

DNA sequence
>NC_022904, from 3915911 to 3915946 (36 bp); Pandoraea pnomenusa 3kgm CCAGCGTTGCCGCCAGCGCCGCCGCCAGTGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3914744-3920914	Sequence	U875_17985 - hemagglutinin (Protein is coded in complementary strand; from 3920914 to 3914744)