Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4002877
End position: 4002918
Length: 42

DNA sequence
>NC_022904, from 4002877 to 4002918 (42 bp); Pandoraea pnomenusa 3kgm GGCGCCTGGCGCTTGGCGCTTGGCGCTTGGCGCTTGGCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4002918-4004330	Sequence	U875_18380 - chemotaxis protein (Protein is coded in complementary strand; from 4004330 to 4002918)