Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4054524
End position: 4054547
Length: 24

DNA sequence
>NC_022904, from 4054524 to 4054547 (24 bp); Pandoraea pnomenusa 3kgm GCGTCGGCGGCGGCATCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4053219-4054670	Sequence	U875_18595 - salicylaldehyde dehydrogenase (Protein is coded in complementary strand; from 4054670 to 4053219)