Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4062622
End position: 4062645
Length: 24

DNA sequence
>NC_022904, from 4062622 to 4062645 (24 bp); Pandoraea pnomenusa 3kgm CTCGCGCACGCGCTCGAGTTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4061708-4064152	Sequence	U875_18640 - chemotaxis protein CheA (Protein is coded in complementary strand; from 4064152 to 4061708)