Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4091725
End position: 4091748
Length: 24

DNA sequence
>NC_022904, from 4091725 to 4091748 (24 bp); Pandoraea pnomenusa 3kgm GCGCCGGCGCCGACGCCGACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4091628-4091834	Sequence	U875_18730 - hypothetical protein (Protein is coded in complementary strand; from 4091834 to 4091628)