Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4211916
End position: 4211939
Length: 24

DNA sequence
>NC_022904, from 4211916 to 4211939 (24 bp); Pandoraea pnomenusa 3kgm CGCGCCTGCGCCTGCGCCTGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4211094-4212095	Sequence	U875_19315 - lytic transglycosylase (Protein is coded in complementary strand; from 4212095 to 4211094)