Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4243083
End position: 4243115
Length: 33

DNA sequence
>NC_022904, from 4243083 to 4243115 (33 bp); Pandoraea pnomenusa 3kgm GCCGCTCGTCAGCCGCTCATCAGCCGCGCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4243103-4243729	Sequence	U875_19485 - 2-dehydro-3-deoxyphosphogluconate aldolase (Protein is coded in complementary strand; from 4243729 to 4243103)