Sequence retrieval

Genome: Pandoraea pnomenusa 3kgm
Start position: 4247540
End position: 4247564
Length: 25

DNA sequence
>NC_022904, from 4247540 to 4247564 (25 bp); Pandoraea pnomenusa 3kgm CGCGGCGCGGCGCGCCACGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4247058-4248038	Sequence	U875_19500 - bifunctional glyoxylate/hydroxypyruvate reductase B (Protein is coded in complementary strand; from 4248038 to 4247058)